Introduction to Recombinant Genetics- Biology 350

Genomic Sequencing

Very Nice Tutorial by Arthur Gruber

NCBI Genomic Sequence Assembly and Annotation Process

•Large region purified and broken into 100 kb or slightly larger random fragments •Fragments cloned into vectors: eg. yeast artificial chromosomes (YACs) or bacterial artificial chromosomes (BACs)
•library of clones screened for overlapping contigs
•Once map obtained, unique overlapping clones chosen for sequencing
•Clones too large for direct sequencing
•Clone is broken down into subclones, with some level of redundancy (typically 4x – 10x coverage)
•Subclones (500 bases) are sequenced
•subclones assembled based on overlapping sequences (and mapping information)

Shotgun sequencing

•Map data is ignored
•Both ends of DNA fragments of short (2kb), medium (10 kb) and long (100 kb) fragments sequenced
•End sequences used as anchors
•Genome randomly broken up into small (500 base) pieces which are then sequenced

shotgun sequencing

 

DNA Sequence assembly

Try to assemble the four fragments below:

cacaaaatataagaaggaaaagtgctgatt

tgctgattttcctacctttgtgtttcatga

cttaaaaccaatgtctcataaatcatgaaa

gttttaagcaaaactgagttagagcaactc



cacaaaatataagaaggaaaagtgctgatt
                      tgctgattttcctacctttgtgtttcatga              gttttaagcaaaactgagttagagcaactc
                                            TTTCATGATTTATGAGACATTGGTTTTAAG

                                              reverse complement ^

                                            cttaaaaccaatgtctcataaatcatgaaa

 

Required overlaps for contig assembly usually at least 20 bp up to 100 bp

Genome assembly Programs

PHRAP - most commonly used
Arachne
CAP3
•GigAssembler
•Phusion

© 2005 by CA Rinehart Index  •  Syllabus  •  CourseInfo LogIn  •  References  •  Assignment  •  Next
This material is intended for use only by WKU students registered for Biology 350. Other uses prohibited.