Introduction to Molecular and Cell Biology, Biol. 220
Lecture 16: Recombination
| Index | CourseInfo LogIn | Syllabus | References | Other Resources |
| |
Introduction to Molecular and Cell Biology, Biol. 220 Lecture 16: Recombination |
||||
|
Homologous recombination
What are homologous sequences?
5'CGATCCGTAAACGGTTTCGGGC3'
5'GCTACCGTAAACGGTATCCCCG3'
What is recombination?
The exchange of genetic information between parental chromosomes.
Fig. 12.29 Holliday model
of genetic recombination.
What is heteroduplex DNA?
Looking at figure 12.29 above, it is the double-stranded DNA that has one strand from each parent, ie., Bb' and B'b.
What are the two possible outcomes of recombination?
Strand exchange (Patched). The right products in figure 12.29.
Full recombination (Spliced). The left products in figure 12.29.
What proteins are involved in recombination? (movie)
Endonucleases (Rec BCD.)
Helicases
RecA
DNA ligase
Ruv AB & C
Alternative double-stranded break model of recombination. (movie)
Fig. 12.31 Double-strand
break model of meiotic recombination in the yeast S. cerevisiae.
What happens to heteroduplex regions when the bases do not pair properly?
5'CGATCCGTAAACGGTTTCGGGC3'
3' GCTAGGCTTTTCCCATAGCCCG5'
Gene Conversion occurs as DNA repair mechanisms fix mismatches.
5'CGATCCGAAAAGGGTATCGGGC3' convert to parent 1
3' GCTAGGCTTTTCCCATAGCCCG5'
5'CGATCCGTAAACGGTTTCGGGC3' convert to parent 2
3' GCTAGGCATTTGCCAAAGCCCG5'
5'CGATCCGAAAACGGTATCGGGC3' blend parental DNA
3' GCTAGGCTTTTGCCATAGCCCG5'
Parent 1 DNA blended DNA Parent 2 DNA
Site-specific recombination
Another type of recombination occurs that does not require extensive homology between the two DNAs that are to recombine. Site-specific recombination usually requires only short regions of homology, (5-15 bp) and the specificity is mainly stabilized with the aid of proteins.
Several bacteriophages (P1, Fig 12.36) and viruses (HIV) integrate into the host genome using this type of recombination. Bacteriophages also use this mechanism to excise themselves from the host genome (P1, Fig 12.36).
Fig. 12.36 Site-specific
recombination between loxP sites on multimeric copies of the P1 phage.
Recombination and generation of immune diversity
Your immune system is derived from stem cells that reside in your bone marrow.
As bone marrow cells develop, some become B or T lymphocytes that responsible for your humoral or cellular immunity respectively. Since your immune system needs to be able to respond to a wide variety of antigens, they must use a mechanism in development that creates a diversity of receptors within the lymphocyte population such that one or more of the cells can respond to foreign invaders into the body.
Recombination is involved in the rearrangement of specific DNA sequences that alter the expression and function of some genes during development and differentiation of lymphocytes. For example, B cells make immunoglobulins (heavy chain movie, light chain movie), which are the important antibodies of the immune system. This type of immunity is stimulated by vaccines.
Recombination is important in gene families.
After completing the sequencing of several genomes, it is obvious that a number of genes are similar to each other and can be grouped into families.
Recombination is important in the generation and maintenance of gene families.
Fig. 9.5 Gene Duplication resulting
from unequal recombination.
Recombination is used in repair of DNA following replication
Recombination is also an important mechanism for repairing damaged DNA (movie).
| Created 2004 by CA Rinehart• email CA Rinehart | Index • CourseInfo LogIn • Syllabus • References • Other Resources |