Lecture

Introduction to Molecular and Cell Biology, Biol. 220

Lecture 18: Transcription in Prokaryotes

Transcription in E. coli (in prokaryotes):

Enzyme involved in transcription- DNA dependent RNA polymerase

RNA polymerase activity: some similarities, some differences to DNA polymerase activities

Similarities:

Differences:

uses ribonucleoside 5'-triphosphates instead of deoxyribonucleoside 5'-triphosphates (ATP, GTP, CTP, UTP)
can initiate the start of a new strand de novo (no primer necessary) (remember the RNA polymerase "primase" in replication)
a single strand of RNA is produced (only one strand of DNA used for RNA synthesis: the DNA template strand with complementary base sequence)
only short stretches of DNA are transcribed
Only one RNA polymerase to make all RNA, i.e., mRNA, rRNA, and tRNA.

E. coli RNA polymerase

Very large protein complex, consists of five subunits (Fig 10.10).
Fig. 10.10 Binding of RNA Polymerase at an E.coli promoter.
2 identical alpha subunits and 1 each of beta, beta', and sigma.
The sigma subunit dissociates from the enzyme easily - leaves shortly following initiation, critical for recognition of start of gene.
holoenzyme - complete enzyme - all five subunits together but basic polymerization reaction possible without sigma subunit -
core enzyme: 2 alpha, 1 beta and 1 beta'

Organization of control regions.

The location on the DNA where proteins bind can be identified through footprinting (Fig. 10.6).

Fig. 10.6 DNA Footprinting.

The lactose operon illustrates a typical prokaryotic organization (Fig 10.9).

Fig. 10.9 Localization of RNA polymerase and regulator footprints on lac operon.

The base where transcription starts is numbered +1.
Bases distal of the +1 base from the coding region are referred to as upstream and are number as: -1, -2, -3 ...
Those bases adjacent to the +1 base close to the coding region are referred to as downstream and are positively numbered.
The regions of DNA that bind RNA polymerase are called promoters.
The regions of DNA that bind regulatory proteins are called operators.

Consensus Binding Sites

Alignment of several promoters helps identify common sequences that may be important in protein binding (Fig. 10.11a).
Fig. 10.11 (a) alignment of multiple promoters shows conservation at some positions upstream of transcriptional start site. (b) shows the consensus sequences for an E. coli promoter. (c) shows how mutations at the lac promoter can result in increased or decreased transcription according to how well the mutation matches the consensus promoter sequence.
A consensus sequence can be derived from the most conserved bases (Fig. 10.30).
Fig. 10.30 Consensus promoter sequence for a eukaryotic gene illustrating the % conservation at promoter vs the adjacent area.

Question:
What would be the consensus sequence of the following sequences?
     ACCATAGC
     CCCTTAGG
     TCTATTGT
    GCCATAGA
Mutations of bases a specific positions can verify the functional importance of specific bases (Fig. 10.11b).

Promoters

Bacterial promoters have two consensus sequences centered at -10 and -35 (Fig. 10.11b).
The RNA polymerase core uses the -10 sequence (TATAAT) to bind and orient where to begin transcription.
The RNA polymerase sigma subunit uses the -35 (and -10 to some degree) sequence to bind and stabilize the polymerase complex.
Different sigma subunits can direct the polymerase to specific genes. Synthesis of new or unique sigma subunits can redirect the polymerase to transcribe a new set of genes (Table 10.1).
Table 10.1 Various sigma factor recognition sites.
The strength of a promoter is related to its identity to the consensus sequence (Fig. 10.11c).
Not all genes have the -10 and -35 sequence in the promoter.

Operators and Regulatory Proteins

Most operators are short inverted repeats (Fig. 10.12).
Fig. 10.12 Operator sites often have inverted repeat structures.

Find the inverted repeat sequence in the following sequence:
GATCTTATACGTATAAGGCA
CTAGAATATGCATATTCCGT
Most DNA binding proteins have dimer or multimeric subunits containing alpha-helices that bind in the major groove of the operator DNA (Fig. 10.14).
Fig. 10.14 Binding of dimeric form of regulator is usually via alpha helices inserted into the major groove of DNA.
Negative regulator proteins bind such that they prevent RNA polymerase binding or movement (Fig. 10.9).
Fig. 10.9 Localization of RNA polymerase and regulator footprints on lac operon.
Positive regulator proteins often interact with the RNA polymerase and stabilize it at poor promoters that do not closely match the consnsus sequence (Fig. 10.17).
Fig. 10.17 Positive regulation of the Lac operon via cAMP and CAP.
Enhancers can accelerate the conversion of closed complexes into open complexes (Fig. 10.19).
Fig. 10.19 How enhancers can work.
Many bacterial responses are controlled by two-component regulatory systems (Fig. 10.19, Fig. 10.21).
Fig. 10.21 Many gene responses depend on two proteins, one for sensing and one for responding.

Phases of transcription

Specific binding of RNA polymerase:

RNA polymerase can bind to double-stranded DNA nonspecifically with low affinity (low strength)
The holoenzyme (with sigma subunit) binds specifically to both the -10 and -35 sequence with high affinity ---- resulting in a closed-promoter complex
The holoenzyme unwinds about 15 bases in double-stranded DNA around the initiation site for transcription ---- resulting in an open-promoter complex

Initiation:

Transcription starts by base pairing of two rNTPs that are joined (therefore, the very first ribonucleotide in a newly transcribed RNA retains the triphosphate)
When approximately 10 rNTPs are jointed by phosphodiester bonds [resulting in the loss of 2 phosphate groups from each rNTP], the sigma subunit is released from the core enzyme

Elongation:

The core enzyme leaves the promoter site
The core enzyme travels along DNA template
The DNA is unwound in front and is rewound behind so that approximately 17 base pairs are always unwound
rNTPs are added to growing RNA via base pairing and phosphodiester bond formation

Termination: